Do we really need to weigh lives against money? If so, how do you do it right? […] As human beings, we tend to see life as having almost infinite value, but it’s also worth remembering that money spent to save one life has an opportunity cost: It could have been spent in another fashion and—if spent more efficiently—saved even more lives. Resources are never unlimited, and without assessing the dollars-to-lives tradeoff, it’s likely that policymakers will fail to save as many lives as they otherwise could. […] Here’s where assigning a dollar value to life-extending benefits enters the equation. One common way to do this is by using the “value of a statistical life,” or VSL, which reflects what current citizens are willing to pay to reduce their own risk of death. (It’s usually estimated by looking at how much extra compensation workers in dangerous professions get paid.) Estimates of the VSL vary, but tend to average about $10 million for Americans. If we assume, for example, that the government’s response to Covid-19 prevents an enormous death toll of 2 million citizens, the value of all those prevented deaths could be as much as $20 trillion. […] Cost-benefit analysis can offer us a way to think about decisions, and put some boundaries around the likely outcomes. But even in simpler circumstances, it cannot always provide bright-line recommendations. And it can’t answer our deepest and most profound questions. In some cases, the calculus has to be driven not by a set of numbers, but by our values. […] Contrary to popular belief, deaths go down during economic downturns. […] Suicides tend to be low in wartime […] The economy took a hit during the 1918 influenza pandemic, but cities that intervened earlier and more aggressively fared better. [Politico]

It is hard to start a new business, and if all the businesses shut down then it will be hard to start all new ones when the lockdowns end. […] The U.S. government has announced that small businesses can apply to banks for loans to cover their payrolls, and that if they actually use the money to pay workers—if they don’t lay people off—then the government’s Small Business Administration will forgive the loans. […] It is all very smart and elegant but there is a problem, which is that banks are a little nervous about vetting companies for the government and might just decline to do it. (The government will also guarantee the loans, even the ones that aren’t forgiven, so the banks take no credit risk.) Banks are, precisely, in the business of vetting applications from local restaurants, examining their financial records and deciding how much money they need. The government, meanwhile, is best equipped to generate magical quantities of money. […] It is all very smart and elegant but there is a problem, which is that banks are a little nervous about vetting companies for the government and might just decline to do it. [Matt Levine | Bloomberg]

Rich countries try radical economic policies to counter covid-19. History suggests that the effects will be permanent. [Economist]

This virus does have the ability to transmit far easier than flu. It’s probably now about three times as infectious as flu. One of the [pieces of] information that we have pretty much confirmed now is that a significant number of individuals that are infected actually remain asymptomatic. That may be as many as 25%. […] Of those of us that get symptomatic, it appears that we’re shedding significant virus in our oropharyngeal compartment, probably up to 48 hours before we show symptoms. This helps explain how rapidly this virus continues to spread across the country, because we have asymptomatic transmitters and we have individuals who are transmitting 48 hours before they become symptomatic. […] This virus cannot go from person to person that easily. It needs us to be close. It needs us to be within 6 feet. If we just distance ourselves, this virus can’t sustain itself and it will go out. [Dr. Robert Redfield, CDC Director | NPR]

Inside the Coronavirus Genome
Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome. The first sequence of RNA letters reads: auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

Two episodes from The Daily, NY Times podcast: The Race for the Vaccine and Why the U.S. Is Running Out of Medical Supplies

It’s theoretically possible that coronavirus could infect the region of the brain responsible for smell. […] “The pure smell sense would be if you can smell a particular substance that’s not stimulating other nerves. […] For example, Ammonia or cleaning solutions, those stimulate the trigeminal nerve, which is an irritant nerve. And so people will think, ‘Oh, I can smell Clorox, I can smell ammonia, which means I can smell.’ But no, that’s not correct. They’re not actually smelling, they’re using the trigeminal nerve.”

For the first time in history, most American adults carry an always-on geolocation device—their smartphone—on their person most of the time. Many popular smartphone apps passively transmit user location—via cellular, GPS, WiFi, or Bluetooth technology—to app companies at all hours of the day. […] These are rich datasets that public health officials and researchers are using to evaluate shelter-at-home compliance and model COVID-19 transmission speeds. For example, officials in Austria and Italy are already using anonymized location information from mobile phone company records to examine the efficacy of their COVID-19 lockdowns.  Similar analysis is underway in the United States. […] If most residents are spending 22 hours in one location except for brief visits to the grocery store and parks, that is a reliable sign that people are engaging in fairly strict social distancing behaviors […] Combining these data with reported infection and hospitalization rates will allow policymakers to analyze various jurisdictions and geographic areas based on a matrix of risk levels. [Mercatus]

No-Sew Pleated Face Mask with Handkerchief and Hair Tie

Cumulative counts of COVID-19 cases by U.S. state over time

A pilot wrote a coronavirus message in the sky [March 19]

Unsolicited Advice for Living in the End Times

‘Zoombombing’ is a federal offense that could result in imprisonment, prosecutors warn

unrelated:

Have Smartphones Destroyed a Generation?

The caption of this photo probably triggered one of the biggest edit wars in Wikipedia’s history.

The World vs. SARS-CoV-2 | April 3rd, 2020